Primers used were a common 5′ primer (GCGGATCCTGTTACCTATCTCAGAGACTC) that contained а ВатШ restriction site and two 3′ primers (GCGAATTCTCAAGGTGAGTTCAGATCTCC for p3 and GCGAATTCTCAACCCATCTTTGTTAACCT for рЗТтб). Both 3′ primers contained an EcoKl restriction site to allow directional insertion into the expression vector. Amplicons were cloned into the pGEX-2T vector by using T4 DNA ligase after double restriction digestion with ВатШ and £coRI. The plasmids were used to transform JM109 E. coli. Proper insertion of cDNA and fidelity of sequences were verified by DNA sequencing. Vectors were transformed into BL21-pLysS E. coli. Recombinant proteins were produced as fusion proteins with glutathione transferase and were purified by affinity chromatography. The IFN-ts were cleaved from the fusion protein by proteolysis with thrombin. asthma inhalers

Electrophoresis and Western Blotting

Recombinant protein preparations were analyzed by electrophoresis in 12.5% (w:v) polyacrylamide gels containing 0.1% (w:v) SDS. Gels were either silver-stained or subjected to Western blot analysis. Immunizing rabbits with a mixture of ovIFN-ts purified from medium used for culture of Day 15 and Day 16 ovine conceptuses generated the antiserum used for Western blotting. Antiserum was used at a 1:1000 dilution (v:v) in 0.01 M Tris (pH 8.0), 0.15 M NaCl, and 0.05% (w:v) Tween-20. Goat antirabbit IgG-alkaline phosphatase conjugate (1:7500; v:v) was used to visualize bound immunoglobulins on blots.

Category: Biological Activity / Tags: Biological Activity, Carboxyl Amino Acid, Interferon, Ovine